CARD ID | 1688 | |
Type of strain | Targeted mutant. | |
Strain name | B6.129-Cckartm1 | |
Internal Code | C57BL/6-Cckartm1 | |
Submitter | Okamura Takeshi | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | National Kyushu Cancer Center |
Organization code | ||
Developer | Soich Takiguchi | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Cckar |
Gene name | Cholecystokinin A receptor |
Allele symbol | Cckartm1 |
Allele name | Cholecystokinin A receptor; targeted mutation 1, Soichi Takiguchi |
MGI | |
Chromosome | 5 (29.52) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
CCKA-1 | AGTGAGCCATTCACCAGCTCGCCAG |
LacZ-1 | CGCTATTACGCCAGCTGGCGAAAGG |
Disease name, Applicable field | Physiology, cancer, Neurobiology, Metabolism |