| CARD ID | 2678 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Ehbp1tm1 | |
| Internal Code | EHBP1 KO | |
| Submitter | - - | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Osaka Univ.Grad Sch Med, Dept cell Biol |
| Organization code | ||
| Developer | Akihiro Harada | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Ehbp1 |
| Gene name | EH domain binding protein 1 |
| Allele symbol | Ehbp1tm1 |
| Allele name | EH domain binding protein 1, targeted mutation 1, |
| MGI | MGI:2667252, |
| Chromosome | 11 (14.10) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| EHBP1-F | CCTGTGAGACAGGGAGAAGACTTATGG |
| EHBP1-R | GTGTTCTCAGTTGTAGTCCTCTGAGACG |
| Disease name, Applicable field |