CARD ID | 1047 | |
Type of strain | Targeted mutant. | |
Strain name | B6.129-Cirbptm1 | |
Internal Code | CIRP KO | |
Submitter | Teranishi Yutaka | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Dep of Clin Mol Biol, Faculty of Med, Kyoto University |
Organization code | ||
Developer | Jun Fujita | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Cirbp |
Gene name | cold inducible RNA binding protein |
Allele symbol | Cirbptm1 |
Allele name | cold inducible RNA binding protein, targeted mutation 1 |
MGI | MGI:893588, |
Chromosome | 10 (44.0) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
OP4170 | 5'gcccagaaagcgaaggagcaaag3' |
OP4240 | 5'gcttcgtgaagccaaagaaactgcgtaca3' |
Disease name, Applicable field | Unknown |