CARD ID | 2128 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6N-Crisp2tm1a(KOMP)Osb/6FOsb | |
Internal Code | B6-Crisp2-tm1a | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
Organization code | - | |
Developer | Masahito Ikawa | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Crisp2 |
Gene name | cysteine-rich secretory protein 2 |
Allele symbol | Crisp2tm1a(KOMP)Osb/6FOsb |
Allele name | cysteine-rich secretory protein 2; targeted mutation 1a, Research Institute for Microbial Diseases, Osaka University |
MGI | MGI:98815, |
Chromosome | |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
5560 | GTGCACATAAGTGTTATTCCTGCTATCTTG |
5083 | ACTGATGGCGAGCTCAGACC |
Author | N G Brukman, H Miyata, P Torres, D Lombardo, J J Caramelo, M Ikawa, V G Da Ros, P S Cuasnicú |
Title | Fertilization defects in sperm from Cysteine-rich secretory protein 2 (Crisp2) knockout mice: implications for fertility disorders |
Journal | Mol Hum Reprod. |
Volume | 22(4) |
Page | 240-51. |
Year | 2016 |
PMID | 26786179 |
Disease name, Applicable field | Development |