CARD R-BASE



Mouse strain


Strain information

CARD ID 2133
Type of strain Targeted mutant.
Strain name B6D2-Bsph1tm1a(EUCOMM)Osb/7A
Internal Code Bsph1 KO
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Consent to us
Using the BIOLOGICAL RESOURCE is limited to the academic research of academic institutions. The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it as well as consent for collaborative research from the DEPOSITOR.These strains were established by the DEPOSITOR by using knockout vectors of EUCOMM Consortium.The RECIPIENT shall acknowledge the EUCOMM Consortium as the source of the vectors of the strains.
In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested.
The RECIPIENT must contact the DEPOSITOR in the case of application for any patents or commercial use based on the results from the use of the BIOLOGICAL RESOURCE. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.
Production method
Origin (In-house) Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Organization code Osb
Developer Masahito Ikawa
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Bsph1
Gene name binder of sperm protein homolog 1
Allele symbol Bsph1tm1a(EUCOMM)Osb/7A
Allele name binder of sperm protein homolog 1; targeted mutation 1a, Research Institute for Microbial Diseases, Osaka University
MGI MGI:2685613,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Bsph1-4 GTATAGGATCCTCCCTGGAGCCTGAG
LAR3 CACAACGGGTTCTTCTGTTAGTCC


Disease , Applicable field information

Disease name, Applicable field Development






Copyright @ 2021 Kumamoto University. All rights reserved.