CARD ID | 1126 | |
Type of strain | Targeted mutant. | |
Strain name | B6.129-Cthtm1 | |
Internal Code | Cth-Knockout | |
Submitter | ISHII ISAO | |
Submitter affiliation or code | Showa Pharmaceutical University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Showa Pharmaceutical University |
Organization code | 不明 | |
Developer | Isao Ishii | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Cth |
Gene name | cystathionase (cystathionine gamma-lyase) |
Allele symbol | Cthtm1 |
Allele name | cystathionase (cystathionine gamma-lyase); targeted mutation |
MGI | MGI:1339968, |
Chromosome | 3 (3H4) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | MicroInjection |
OMIM |
Cth-1(CSE-F2) | TGCCGACCAATAAGCAGGGC |
Cth-2(CSE-PCR-1) | AAAATCACGTTGTTGGTCAA |
Author | Yamada H, Akahoshi N, Kamata S, Hagiya Y, Hishiki T, Nagahata Y, et al. |
Title | Methionine excess in diet induces acute lethal hepatitis in mice lacking cystathionine gamma-lyase, an animal model of cystathioninuria. |
Journal | Free Radic Biol Med |
Volume | 52 |
Page | 1716-1726 |
Year | 2012 |
PMID |
Author | Akahoshi N, Kamata S, Kubota M, Hishiki T, Nagahata Y, Matsuura T, et al. |
Title | Neutral aminoaciduria in cystathionine beta-synthase-deficient mice, an animal model of homocystinuria. |
Journal | Am J Physiol Renal Physiol |
Volume | 306 |
Page | F1462-F1476 |
Year | 2014 |
PMID |
Author | Hagiya Y, Kamata S, Mitsuoka S, Okada N, Yoshida S, Yamamoto J, et al. |
Title | Hemizygosity of transsulfuration genes confers increased vulnerability against acetaminophen-induced hepatotoxicity in mice. |
Journal | Toxicol Appl Pharmacol |
Volume | 282 |
Page | 195-206 |
Year | 2015 |
PMID |
Author | Nakano S, Ishii I, Shinmura K, Tamaki K, Hishiki T, Akahoshi N, et al. |
Title | Hyperhomocysteinemia abrogates fasting-induced cardioprotection against ischemia/reperfusion by limiting bioavailability of hydrogen sulfide anions. |
Journal | J Mol Med |
Volume | 93 |
Page | 879-889 |
Year | 2015 |
PMID |
Author | Szijarto IA, Marko L, Filipovic MR, Miljkovic JL, Tabeling C, Tsvetkov D, et al. |
Title | Cystathionine gamma-lyase-produced hydrogen sulfide controls endothelial NO bioavailability and blood pressure. |
Journal | Hypertension |
Volume | 71 |
Page | 1210-1217 |
Year | 2018 |
PMID |
Author | Isao Ishii, Noriyuki Akahoshi, Hidenori Yamada, Shintaro Nakano, Takashi Izumi, and Makoto Suematsu |
Title | Cystathionine gamma-Lyase-deficient Mice Require Dietary Cysteine to Protect against Acute Lethal Myopathy and Oxidative Injury |
Journal | J. Biol. Chem. |
Volume | 285 |
Page | 26358-26368 |
Year | 2010 |
PMID |
Disease name, Applicable field | Physiology, Development, Metabolism |