CARD ID | 2555 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-Stra8tm1(GFP) | |
Internal Code | St8-3xFLAG-HA-GFP (B6) | |
Submitter | Ishiguro Kei-ichiro | |
Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
Collaboration permission is required for usage of this line |
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Department of Chromosome Biology Institute of Molecular Embryology and Genetics, Kumamoto University |
Organization code | ||
Developer | Kei-ichiro Ishiguro | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Stra8 |
Gene name | Stimulated by retinoids acid 8 |
Allele symbol | Stra8tm1(GFP) |
Allele name | Stimulated by retinoids acid 8, targeted mutation 1, |
MGI | MGI:107917, |
Chromosome | 6 (15.20) (B1) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
St8-24996F | AGGCCCAGCATATGTCTAACATCAG |
KI92ES-29564R | AGAAGGCTTTTGGAAGCAGCCTTTC |
Author | Ishiguro K, Matsuura K, Tani N, Takeda N, Usuki S, Yamane M, Sugimoto M, Fujimura S, Hosokawa M, Chuma S, Ko S.H.M, Araki K, Niwa H. |
Title | MEIOSIN directs the switch from mitosis to meiosis in mammalian germ cells. |
Journal | Dev. Cell |
Volume | 52(4) |
Page | 429-445 |
Year | 2020 |
PMID |
Disease name, Applicable field | Molecular biology |