CARD ID | 1427 | |
Type of strain | Targeted mutant. | |
Strain name | B6.129-Atp1a3tm1Kwk | |
Internal Code | B6;129-Atp1a3tm1Kwk | |
Submitter | KAWAKAMI KIYOSHI | |
Submitter affiliation or code | jichi medical university | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Jichi Medical University |
Organization code | ||
Developer | Kiyoshi Kawakami | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Atp1a3 |
Gene name | ATPase, Na+/K+ transporting, alpha 3 polypeptide |
Allele symbol | Atp1a3tm1Kwk |
Allele name | ATPase, Na+/K+ transporting, alpha 3 polypeptide; targeted mutation, Kiyoshi Kawakami |
MGI | |
Chromosome | 7 (13.73) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
StopF2(5447-5476) | CATACTGTTTTTTCTTACTCCACACAGGCA |
ShortArmR1(5949-5921) | CAGAGAAAAAAATGGAGCTGGAACCTGAG |
Disease name, Applicable field | Physiology, Anatomy, Development |