| CARD ID | 2385 | |
| Type of strain | Targeted mutant. | |
| Strain name | BALB/c- Rag2tm1Jak3tm1Fahtm1 | |
| Internal Code | BRJ-Fah | |
| Submitter | Ken-ichi YAMAMURA | |
| Submitter affiliation or code | Center for Animal Resources and Development Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Center for Animal Resource and Development, Kumamoto University |
| Organization code | ||
| Developer | Ken-ichi Yamamura | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | Maintenance and rearing with water containing NTBC (7.5mg/L). | |
| Gene symbol | Rag2 |
| Gene name | recombination activating gene 2 |
| Allele symbol | Rag2tm1 |
| Allele name | recombination activating gene 2, targeted mutation 1 |
| MGI | MGI:97849, |
| Chromosome | 2 (53.87) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| Gene symbol | Jak3 |
| Gene name | Janus Kinase 3 |
| Allele symbol | Jak3tm1 |
| Allele name | Janus Kinase 3, targeted mutation 1 |
| MGI | MGI:99928, |
| Chromosome | 8 (34.43) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| Gene symbol | Fah |
| Gene name | fumarylacetoacetate hydrolase |
| Allele symbol | Fah3tm1 |
| Allele name | fumarylacetoacetate hydrolase, targeted mutation 1 |
| MGI | MGI:95482, |
| Chromosome | 7 (48.36) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Fah-Fw | CTCTGCAGGAGACTACACGGACTTCTACTC |
| Fah-Re | CCAATTTGGCAACAGCGCATTCTCCTTGCC |
| Disease name, Applicable field | Laboratory-animal Science, cancer, Urology, Digestive Disorders |