CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2851
Type of strain Spontaneous/Chemical induced mutant., Targeted mutant.
Strain name NOD.Cg-Prkdcscid,Hrhr,Jak3tm1
Internal Code Hairless NOJ
Submitter Unknown Unknown
Submitter affiliation or code
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Division of Hematopoiesis, Joint Research Center for Human Retrovirus Infection, Kumamoto University
Organization code Card
Developer Seiji Okada
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Hr
Gene name lysine demethylase and nuclear receptor corepressor
Allele symbol Hrhr
Allele name lysine demethylase and nuclear receptor corepressor
MGI MGI:96223,
Chromosome 14 (36.32) ,
Gene classification Other gene(mutant etc.)
Method
OMIM
Gene symbol Jak3
Gene name Janus kinase 3
Allele symbol Jak3tm1
Allele name Janus kinase 3, targeted mutation 1,
MGI MGI:99928,
Chromosome 8 (34.43 ) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM
Gene symbol Foxn1
Gene name forkhead box N1
Allele symbol Foxn1nu
Allele name
MGI MGI:102949,
Chromosome 11 (46.74) ,
Gene classification Other gene(mutant etc.)
Method
OMIM

PCR Primer 1
Oligo1 CCA GAC CAG CAG AGG GAC TT
Oligo2 GAA CCT GCG TGC AAT CCA TCT TG
Oligo3 ACC CAG GTA CTC CAT GCC CT
PCR Primer 2
am05 GCGTTACTGCAGCTAGCTTG
am06 TGTAGCCTGTGGTCGCATAG
am07 CTCCTGTTTGCTTGGTCATC


Disease , Applicable field information

Disease name, Applicable field Aging, X ray irradiation, Molecular biology, Development, Laboratory-animal Science, Cell biology, Immunology, infectious, cancer, Dermatology






Copyright @ 2021 Kumamoto University. All rights reserved.