CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2075
Type of strain Inbred., Spontaneous/Chemical induced mutant.
Strain name C57BL/6-Sh2d1arpl
Internal Code C57BL/6.sap-/sap-
Submitter Ono Masao
Submitter affiliation or code Department of Pathology, Tohoku University Graduate School of Medicine
Stock Type
Material Transfer Conditions No condition
Production method in-house breeding
Origin (In-house) Organization Tohoku University Graduate School of Medicine
Organization code
Developer Masao Ono
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Sh2d1a
Gene name SH2 domain containing 1A
Allele symbol
Allele name
MGI MGI:1328352,
Chromosome X (23.20) ,
Gene classification Other gene(mutant etc.)
Method
OMIM
Gene symbol
Gene name
Allele symbol
Allele name
MGI
Chromosome
Gene classification Other gene(mutant etc.)
Method
OMIM

PCR Primer 1
mSAP-1 GAGAAGCTCTTACTCGGTA
mSAP-2 CCACTACCACGAGATATACT


References

Author Hiroaki Komori, Hiroshi Furukawa, Shiro Mori, Mitsuko R. Ito, Miho Terada,
Title A Signal Adaptor SLAM-Associated Protein Regulates
Journal J Immunol
Volume 176
Page 395–400
Year 2006
PMID


Disease , Applicable field information

Disease name, Applicable field Laboratory-animal Science, Genetics






Copyright @ 2021 Kumamoto University. All rights reserved.