CARD ID | 2211 | |
Type of strain | Transgenic., Targeted mutant. | |
Strain name | STOCK-Cd9tm1Tg(Svs2)Kemi | |
Internal Code | SVS2KO BACTG | |
Submitter | Unknown Unknown | |
Submitter affiliation or code | ||
Stock Type | ||
Material Transfer Conditions |
Consent to us
Joint research |
|
Production method | in-house breeding | |
Origin (In-house) | Organization | National Research Institute for Child Health and Development |
Organization code | ||
Developer | Kenji Miyado | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Svs2 |
Gene name | seminal vesicle secretory protein 2 |
Allele symbol | |
Allele name | |
MGI | MGI:1858275, |
Chromosome | Unknown , |
Gene classification | Gene to express(transgenic) |
Method | MicroInjection |
OMIM |
Gene symbol | Cd9 |
Gene name | CD9 antigen |
Allele symbol | |
Allele name | |
MGI | MGI:88348, |
Chromosome | 2 (84.82) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
GO | Gene Ontology |
OMIM | OMIM ID: 143030 Human Gene Symbol: CD9, |
SalI_F1 | atgtcaccaggggcagtaag |
NotI_R1 | gtggacccaggacttcttca |
Author | Natsuko Kawano, Naoya Araki, Kaoru Yoshida, Taku Hibino, Naoko Ohnami, Maako Makino, Seiya Kanai, Hidetoshi Hasuwa, Manabu Yoshida, Kenji Miyado, Akihiro Umezawa |
Title | Seminal vesicle protein SVS2 is required for sperm survival in the uterus |
Journal | Proceedings of the National Academy of Sciences |
Volume | 111 |
Page | 4145-4150 |
Year | 2014 |
PMID |
Disease name, Applicable field | Development |