CARD R-BASE



Mouse strain


Strain information

CARD ID 2160
Type of strain Targeted mutant.
Strain name STOCK Tsga13tm1a(KOMP)Osb/1B
Internal Code Tsga13 KO
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Organization code Osb
Developer Masahito Ikawa
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Tsga13
Gene name testis specific gene A13
Allele symbol Tsga13tm1a(KOMP)Osb
Allele name testis specific gene A13, targeted mutaion 1a, Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
MGI MGI:1891413,
Chromosome 6 (12.54) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
#5083 ACTGATGGCGAGCTCAGACC
#5382 GTCAGTGGATCAAAGCCTGTGGG
PCR Primer 2
#6161 GCACCTGGATGTCCCACTCCC
#6162 CTCAGAAGGCAGAGGCAAGTGGATC


References

Author Miyata H, Castaneda JM, Fujihara Y, Yu Z, Archambeault DR, Isotani A, Kiyozumi D, Kriseman ML, Mashiko D, Matsumura T, Matzuk RM, Mori M, Noda T, Oji A, Okabe M, Prunskaite-Hyyrylainen R, Ramirez-Solis R, Satouh Y, Zhang Q, Ikawa M, Matzuk MM.
Title Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice.
Journal Proc Natl Acad Sci U S A.
Volume 113(28)
Page 7704-10
Year 2016
PMID 27357688


Disease , Applicable field information

Disease name, Applicable field Development






Copyright @ 2021 Kumamoto University. All rights reserved.