CARD R-BASE



Mouse strain


Strain information

CARD ID 1283
Type of strain Transgenic.
Strain name C57BL/6-Tg(Plcb2-WGA-GFP)M4Abek
Internal Code Tg(Plcb2-WGA-ires-GFP)M4Abek
Submitter - -
Submitter affiliation or code -
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Graduate Shool of Agricultural and Life Sciences, The University of Tokyo
Organization code 不明
Developer Keiko Abe
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol WGA,GFP
Gene name wheat germ agglutinin, green fluorescent protein
Allele symbol Tg(Plcb2-WGA-ires-GFP)M4Abek
Allele name transgene insertion M4, Keiko Abe
MGI
Chromosome Unknown ,
Gene classification Gene to express(transgenic)
Method MicroInjection
OMIM

PCR Primer 1
EGFP-F1 atggtgagcaagggcgaggagctgttcacc
EGFP-R1 cttgtacagctcgtccatgccgagagtga


Disease , Applicable field information

Disease name, Applicable field Physiology, Anatomy






Copyright @ 2021 Kumamoto University. All rights reserved.