CARD ID | 608 | |
Type of strain | Targeted mutant. | |
Strain name | B6;CB-G5prtm1LrsnImku | |
Internal Code | G5pr-flox, B6;CB-G5prtm1LrsnImku | |
Submitter | Nobuo SAKAGUCHI | |
Submitter affiliation or code | Kumamoto University School of Medicine, Department of Immunoloy | |
Stock Type | ||
Material Transfer Conditions |
Others
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Department of Immunology, Kumamoto University |
Organization code | Imuk | |
Developer | Nobuo Sakaguchi | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | AJ238247 (Genebank accession #) |
Gene name | g5Pr |
Allele symbol | |
Allele name | |
MGI | |
Chromosome | Unknown , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | MicroInjection |
OMIM |
G1 | GAGGGGCCATGGAAATGCAGCATAAACA |
G2 | TCGCAGCTCACCAAGCCGGATTTCTAAAGG |
Author | Yan Xing, Hideya Igarashi, Xiaodan Wang, and Nobuo Sakaguchi |
Title | Protein phosphatase subunit G5PR is needed for inhibition of B cell receptor-induced apoptosis |
Journal | The Journal of Experimental Medicine |
Volume | 202 |
Page | 707-719 |
Year | 2005 |
PMID | 16129705 |
Disease name, Applicable field | Immunology |