| CARD ID | 2211 | |
| Type of strain | Transgenic., Targeted mutant. | |
| Strain name | STOCK-Cd9tm1Tg(Svs2)Kemi | |
| Internal Code | SVS2KO BACTG | |
| Submitter | Unknown Unknown | |
| Submitter affiliation or code | ||
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
Joint research |
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | National Research Institute for Child Health and Development |
| Organization code | ||
| Developer | Kenji Miyado | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Svs2 |
| Gene name | seminal vesicle secretory protein 2 |
| Allele symbol | |
| Allele name | |
| MGI | MGI:1858275, |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| Gene symbol | Cd9 |
| Gene name | CD9 antigen |
| Allele symbol | |
| Allele name | |
| MGI | MGI:88348, |
| Chromosome | 2 (84.82) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| GO | Gene Ontology |
| OMIM | OMIM ID: 143030 Human Gene Symbol: CD9, |
| SalI_F1 | atgtcaccaggggcagtaag |
| NotI_R1 | gtggacccaggacttcttca |
| Author | Natsuko Kawano, Naoya Araki, Kaoru Yoshida, Taku Hibino, Naoko Ohnami, Maako Makino, Seiya Kanai, Hidetoshi Hasuwa, Manabu Yoshida, Kenji Miyado, Akihiro Umezawa |
| Title | Seminal vesicle protein SVS2 is required for sperm survival in the uterus |
| Journal | Proceedings of the National Academy of Sciences |
| Volume | 111 |
| Page | 4145-4150 |
| Year | 2014 |
| PMID |
| Disease name, Applicable field | Development |