CARD ID | 3298 | |
Type of strain | Targeted mutant. | |
Strain name | B6D2-Serpina16em1Kms Serpina16em2Kms | |
Internal Code | B6D2-Serpina16 |
|
Submitter | Taichi Noda | |
Submitter affiliation or code | Division of Reproductive Biology, IRDA, Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Others
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Div. of Reproductive Biology, IRDA, Kumamoto university |
Organization code | ||
Developer | Taichi Noda | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Serpina16 |
Gene name | serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 16 |
Allele symbol | Serpina16em1Kms |
Allele name | serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 16; endonuclease-mediated mutation 1, Division of Reproductive Biology, Institute of Resource Development and Analysis, Kumamoto University |
MGI | MGI:2684892, |
Chromosome | |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
Gene symbol | Serpina16 |
Gene name | serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 16 |
Allele symbol | Serpina16em2Kms |
Allele name | serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 16; endonuclease-mediated mutation 2, Division of Reproductive Biology, Institute of Resource Development and Analysis, Kumamoto University |
MGI | MGI:2684892, |
Chromosome | |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
Primer1 | GCCACTGGCAGACAGGTTTC |
Primer2 | CCTAGACCCTGCAGAACTTG |
Primer 3 | GCCCAGGGCAAGAAGATAGA |
Author | Taichi Noda 1 2 , Ayumu Taira 1 3 , Hina Shinohara 1 3 , Kimi Araki 3 |
Title | The testis-, epididymis-, or seminal vesicle-enriched genes Aldoart2, Serpina16, Aoc1l3, and Pate14 are not essential for male fertility in mice |
Journal | Exp Anim. |
Volume | |
Page | |
Year | 2023 |
PMID | 36709994 |
Disease name, Applicable field |