| CARD ID | 2075 | |
| Type of strain | Inbred., Spontaneous/Chemical induced mutant. | |
| Strain name | C57BL/6-Sh2d1arpl | |
| Internal Code | C57BL/6.sap-/sap- | |
| Submitter | Ono Masao | |
| Submitter affiliation or code | Department of Pathology, Tohoku University Graduate School of Medicine | |
| Stock Type | ||
| Material Transfer Conditions |
No condition
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Tohoku University Graduate School of Medicine |
| Organization code | ||
| Developer | Masao Ono | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Sh2d1a |
| Gene name | SH2 domain containing 1A |
| Allele symbol | |
| Allele name | |
| MGI | MGI:1328352, |
| Chromosome | X (23.20) , |
| Gene classification | Other gene(mutant etc.) |
| Method | |
| OMIM |
| Gene symbol | |
| Gene name | |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | |
| Gene classification | Other gene(mutant etc.) |
| Method | |
| OMIM |
| mSAP-1 | GAGAAGCTCTTACTCGGTA |
| mSAP-2 | CCACTACCACGAGATATACT |
| Author | Hiroaki Komori, Hiroshi Furukawa, Shiro Mori, Mitsuko R. Ito, Miho Terada, |
| Title | A Signal Adaptor SLAM-Associated Protein Regulates |
| Journal | J Immunol |
| Volume | 176 |
| Page | 395–400 |
| Year | 2006 |
| PMID |
| Disease name, Applicable field | Genetics |