| CARD ID | 2398 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129-ROSA26tm1(tTA-pdx1-EGFP)Miya | |
| Internal Code | RTFN-Pdx1-EGFP | |
| Submitter | Miyazaki Satsuki | |
| Submitter affiliation or code | Division of Stem Cell Regulation Research Osaka University Graduate School of Medicine | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | Miya | |
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | ROSA26 locus |
| Gene name | ROSA26 locus |
| Allele symbol | ROSA26tm1(tTA-pdx1-EGFP)Miya |
| Allele name | |
| MGI | |
| Chromosome | 6 (52.73) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| TetO-S1 | TCCACGCTGTTTTGACCTCC |
| PdxRT-1R | TCCTCTTGTTTTCCTCGGGT |
| Author | Miyazaki S, Tashiro F, Miyazaki J |
| Title | Transgenic Expression of a Single Transcription Factor Pdx1 Induces Transdifferentiation of Pancreatic Acinar Cells to Endocrine Cells in Adult Mice. |
| Journal | PLoS One |
| Volume | 11 |
| Page | e0161190 |
| Year | 2016 |
| PMID |
| Author | Miyazaki S, Tashiro F, Fujikura J, Yamato E, Miyazaki J |
| Title | Acinar-to-ductal metaplasia induced by adenovirus-mediated pancreatic expression of Isl1. |
| Journal | PLoS One |
| Volume | 7 |
| Page | e47536 |
| Year | 2012 |
| PMID |
| Author | Miyazaki S, Yamato E, Miyazaki J |
| Title | Regulated expression of pdx-1 promotes in vitro differentiation of insulin-producing cells from embryonic stem cells. |
| Journal | Diabetes |
| Volume | 53 |
| Page | 1030-1037 |
| Year | 2004 |
| PMID |
| Disease name, Applicable field |