CARD R-BASE



Mouse strain


Strain information

CARD ID 1813
Type of strain Targeted mutant.
Strain name B6;129-Mll1tm1.1Mlc
Internal Code MlldC
Submitter Yokoyama Akihiko
Submitter affiliation or code Kyoto University Graduate School of Medicine Medical Innovation Center Laboratory for Malignancy Control Research DSK project
Stock Type
Material Transfer Conditions Consent to us
Production method From other organizations
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization Stanford University Medical School
Organization code Mlc
Developer Michael L. Cleary
Year introduced 2009 / 5
Introduced Generation
Remarks


Gene information

Gene symbol Mll1
Gene name myeloid/lymphoid or mixed-lineage leukemia 1
Allele symbol Mll1tm1.1Mlc
Allele name myeloid/lymphoid or mixed-lineage leukemia 1; targeted mutation 1.1, Michael L Cleary
MGI MGI:96995,
Chromosome 9 (24.84) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
dC&uc.fwd gttctgaagcacacattccacacc
dC&uc.rev catcaaagcgaagggcaatcagtg


References

Author Yokoyama, A., Ficara, F., Murphy, M. J., Meisel, C., Naresh, A., Kitabayashi, I. and Cleary, M. L.
Title Proteolytically cleaved MLL subunits are susceptible to distinct degradation pathways.
Journal J Cell Sci
Volume 124
Page 2208-2219
Year 2011
PMID


Disease , Applicable field information

Disease name, Applicable field Aging, Molecular biology, Cell biology, cancer, Endocrine Disorders, Hematology






Copyright @ 2021 Kumamoto University. All rights reserved.