CARD R-BASE



Mouse strain


Strain information

CARD ID 1902
Type of strain Gene trap.
Strain name B6.Cg-Tspan9Gt(Ayu21-T162*SACre)1Card
Internal Code Cre driver Tspan9-SACre413
Submitter Masatake ARAKI
Submitter affiliation or code Gene Technology Center, IRDA, Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code Card
Developer Masatake Araki
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Tspan9
Gene name tetraspanin 9
Allele symbol
Allele name
MGI MGI:1924558,
Chromosome 6 ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Cre-1 acatgttcagggatcgccag
Cre-2 taaccagtgaaacagcattgc


Disease , Applicable field information

Disease name, Applicable field Others


EGTC

EGTC番号 Ayu21-T162




Copyright @ 2021 Kumamoto University. All rights reserved.