CARD ID | 2136 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6N-Crisp4tm1a(KOMP)Osb/7E | |
Internal Code | Crisp4 KO | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
Organization code | Osb | |
Developer | Masahito Ikawa | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Crisp4 |
Gene name | cysteine-rich secretory protein 4 |
Allele symbol | Crisp4tm1a(KOMP)Osb/7E |
Allele name | cysteine-rich secretory protein 4; targeted mutation 1a, Research Institute for Microbial Diseases, Osaka University, |
MGI | MGI:1925331, |
Chromosome | |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
Geno1 | ACCCTCACCTATCCTTGCTGGCAG |
LAR3 | CACAACGGGTTCTTCTGTTAGTCC |
Author | Guillermo Carvajal, Nicolás Gastón Brukman, Mariana Weigel Muñoz, María A Battistone, Vanesa A Guazzone, Masahito Ikawa, Miyata Haruhiko, Livia Lustig, Sylvie Breton, Patricia S Cuasnicu |
Title | Impaired male fertility and abnormal epididymal epithelium differentiation in mice lacking CRISP1 and CRISP4 |
Journal | Sci Rep. |
Volume | 8(1) |
Page | |
Year | 2018 |
PMID | 30510210 |
Disease name, Applicable field | Development |