CARD R-BASE



Mouse strain


Strain information

CARD ID 370
Type of strain Targeted mutant.
Strain name B6;129-Dlx5tm1Levi
Internal Code DLx5 KO, B6;129-Dlx5tm1Levi
Submitter Unknown Unknown
Submitter affiliation or code
Stock Type
Material Transfer Conditions Others
Production method From other organizations
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization Giovanni Levi
Organization code Levi
Developer Lab. of. Mol. Bio, Natinal Cancer Inst. Advanced Biotechnology Center
Year introduced 2003 / 1
Introduced Generation
Remarks


Gene information

Gene symbol Dlx5
Gene name distal-less homeobox 5
Allele symbol
Allele name
MGI MGI:101926,
Chromosome 6 (2.0) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
GO Gene Ontology
OMIM OMIM ID: 600028 Human Gene Symbol: DLX5,

PCR Primer 1
primerA 5'(gaagttcagatgtgcggcgagttgcgt)3'
primerB 5'(ccgcacctcgcggaaaccgacatcgcaggc)3'


References

Author Dario Acampora, Giorgio R. Merlo, Laura Paleari, Barbara Zerega, Maria Pia Postiglione, Stefano Mantero, Eva Bober, Ottavia Barbieri, Antonio Simeone and Giovanni Levi
Title Craniofacial, vestibular and bone defects in mice lacking the Distal-less-related gene Dlx5
Journal Development
Volume 126
Page 3795-3809
Year 1999
PMID 10433909


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.