CARD R-BASE



Mouse strain


Strain information

CARD ID 2129
Type of strain Targeted mutant.
Strain name C57BL/6N-Umodl1tm1Osb/1F
Internal Code B6-Umodl1-KO
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Consent to us
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it as well as consent for collaborative research from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.
Production method in-house breeding
Origin (In-house) Organization Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Organization code Osb
Developer Masahito Ikawa
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Umodl1
Gene name uromodulin-like 1
Allele symbol Umodl1tm1Osb/1F
Allele name uromodulin-like 1; targeted mutation 1, Research Institute for Microbial Diseases, Osaka University
MGI MGI:1929785,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
5616 GACTTCACAGGTGGGAGCCAGTGGTCC
5618 CACTCAGGACACTTAGGGGATGTCC
PCR Primer 2
2727 CAGCCTCTGAGCCCAGAAAGCG


Disease , Applicable field information

Disease name, Applicable field Development






Copyright @ 2021 Kumamoto University. All rights reserved.