CARD ID | 2623 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-Gm4969(StIP1) em1 | |
Internal Code | StIP1Ex6 KO | |
Submitter | Ishiguro Kei-ichiro | |
Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Gm4969(StIP1) |
Gene name | predicted gene 4969 |
Allele symbol | Gm4969(StIP1) em1 |
Allele name | predicted gene 4969, endonuclease-mediated mutation 1, |
MGI | MGI:3647482, |
Chromosome | 7 (9.46) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
Gm4969-24679F | CTGTCTTGGAGCCCTGGAATCTGGC |
Gm4969-25037R | CAAGAGGTATGGAAGATCAGCAGGTG |
Author | Kei-ichiro Ishiguro, Kumi Matsuura, Naoki Tani, Naoki Takeda, Shingo Usuki, Mariko Yamane, Michihiko Sugimoto, Sayoko Fujimura, Mihoko Hosokawa, Shinichiro Chuma, Minoru S.H. Ko, Kimi Araki and Hitoshi Niwa |
Title | MEIOSIN directs the switch from mitosis to meiosis in mammalian germ cells |
Journal | Developmental Cell |
Volume | |
Page | |
Year | |
PMID |
Disease name, Applicable field | Cell biology |