CARD ID | 2650 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6N-Vps52tm1.1Card | |
Internal Code | Vps52VADwt | |
Submitter | Araki Kimi | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | Kimi Araki | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Vps52 |
Gene name | VPS52 GARP complex subunit |
Allele symbol | Vps52tm1.1Card |
Allele name | VPS52 GARP complex subunit, targeted mutation 1.1 |
MGI | MGI:1330304, |
Chromosome | 17 (17.98) (17qB1) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
Vps52_genome_F18 | cctttgattctgattaagcctgc |
Vps52VAD_R4 | tacccctgcaagttctgtca |
Author | Michihiko Sugimoto, Masayo Kondo, Michiko Hirose, Misao Suzuki, Kazuyuki Mekada, Takaya Abe, Hiroshi Kiyonari, Atsuo Ogura, Nobuo Takagi, Karen Artzt, and Kuniya Abe |
Title | Molecular Identification of tw5: Vps52 Promotes Pluripotential Cell Differentiation through Cell–Cell Interactions |
Journal | Cell Reports |
Volume | 2 |
Page | 1363-1374 |
Year | 2012 |
PMID |
Disease name, Applicable field | Development, Laboratory-animal Science, Hematology |