CARD ID | 757 | |
Type of strain | Transgenic. | |
Strain name | C57BL/6Slc-Tg(CAG-Per2)MX03-1CCB | |
Internal Code | MX03-1 | |
Submitter | Koyomi Miyazaki | |
Submitter affiliation or code | AIST, Institute of Biological Resource and Function, Clock Cell Biology | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | From other organizations | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | Japan Slc |
Organization code | 不明 | |
Developer | ||
Year introduced | 2001 / 10 | |
Introduced Generation | F | |
Remarks |
Gene symbol | Per2 |
Gene name | period homolog 2 (Drosophila) |
Allele symbol | |
Allele name | |
MGI | MGI:1195265, |
Chromosome | Unknown , |
Gene classification | Gene to express(transgenic) |
Method | MicroInjection |
OMIM | OMIM ID: 603426 Human Gene Symbol: PER2, |
rPer2-MX5-F1 | ACTCAGGCTATGAAGCTCCTAGA |
rPer2-MX5-R1 | GTGCAGAGGGACAGCTAGAC |
Disease name, Applicable field | Physiology, Metabolism |