CARD ID | 1817 | |
Type of strain | Gene trap. | |
Strain name | B6;CB-Etf1Gt(pU-21W)234Card | |
Internal Code | Ayu21-W234 | |
Submitter | Ken-ichi YAMAMURA | |
Submitter affiliation or code | Center for Animal Resources and Development Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | IRDA, Kumamoto University |
Organization code | Card | |
Developer | Kimi Araki | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Etf1 |
Gene name | eukaryotic translation termination factor 1 |
Allele symbol | Etf1Gt(Ayu21-W234)Imeg |
Allele name | eukaryotic translation termination factor 1; gene trap, Institute of Molecular Embryology and Genetics |
MGI | MGI:2385071, |
Chromosome | 18 (18.78) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
Z-1 | GCGTTACCCAACTTAATCG |
Z-2 | TGTGAGCGAGTAACAACCCG |
Disease name, Applicable field | Development |
EGTC番号 | 21-W339 |