CARD ID | 2469 | |
Type of strain | Targeted mutant. | |
Strain name | B6D2-Dppa1em1Osb | |
Internal Code | Dppa1 KO | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Others
|
|
Production method | ||
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | developmental pluripotency associated 1 |
Gene name | Dppa1 |
Allele symbol | Dppa1em1Osb |
Allele name | developmental pluripotency associated 1, endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
MGI | MGI:2157522, |
Chromosome | |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
OMIM |
Primer-1 | GTGGCTACTGAGCGGAAAGA |
Primer-2 | TCCAATGGAATATGGGCCAGT |
Author | Oji A, Noda T, Fujihara Y, Miyata H, Kim YJ, Muto M, Nozawa K, Matsumura T, Isotani A, Ikawa M. |
Title | CRISPR/Cas9 mediated genome editing in ES cells and its application for chimeric analysis in mice. |
Journal | Scientific reports. |
Volume | 6 |
Page | 31666 |
Year | 2016 |
PMID |
Disease name, Applicable field |