CARD ID | 1147 | |
Type of strain | Targeted mutant. | |
Strain name | STOCK Calr3tm1Osb | |
Internal Code | calr3-tm1 | |
Submitter | Masaru Okabe | |
Submitter affiliation or code | Genome Information Research (enter Osaka University) | |
Stock Type | ||
Material Transfer Conditions |
Others
The RECIPIENT must contact the person listed below in the case of application for any patents or commercial use based on the results from the BIOLOGICAL RESOURCES. mta-egr@biken.osaka-u.ac.jp (Contact to Masahito Ikawa) |
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Research Institute for Microbial Diseases,Osaka University |
Organization code | Osb | |
Developer | Masahito Ikawa | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Calr3 |
Gene name | calreticulin3 |
Allele symbol | Calr3tm1Osb |
Allele name | calreticulin3, targeted mutation 1, Research Institute for Microbial Diseases,Osaka University |
MGI | MGI:1920566, |
Chromosome | 8 (35.08) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
1172 | GTCTGTTAGTAGTGTGCATG |
1177 | TTCTGGTCCAGGTCAGACGG |
114 | ATCT ggACgA AgAgCA TCAg |
Author | Ikawa M, Tokuhiro K, Yamaguchi R, Benham AM, Tamura T, Wada I, Satouh Y, Inoue N, Okabe M. |
Title | Calsperin is a testis-specific chaperone required for sperm fertility |
Journal | J Biol Chem |
Volume | 286(7) |
Page | 5639-46 |
Year | 2011 |
PMID |
Disease name, Applicable field | Development, Metabolism |