| CARD ID | 370 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129-Dlx5tm1Levi | |
| Internal Code | DLx5 KO, B6;129-Dlx5tm1Levi | |
| Submitter | Unknown Unknown | |
| Submitter affiliation or code | ||
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | Giovanni Levi |
| Organization code | Levi | |
| Developer | Lab. of. Mol. Bio, Natinal Cancer Inst. Advanced Biotechnology Center | |
| Year introduced | 2003 / 1 | |
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Dlx5 |
| Gene name | distal-less homeobox 5 |
| Allele symbol | |
| Allele name | |
| MGI | MGI:101926, |
| Chromosome | 6 (2.0) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| GO | Gene Ontology |
| OMIM | OMIM ID: 600028 Human Gene Symbol: DLX5, |
| primerA | 5'(gaagttcagatgtgcggcgagttgcgt)3' |
| primerB | 5'(ccgcacctcgcggaaaccgacatcgcaggc)3' |
| Author | Dario Acampora, Giorgio R. Merlo, Laura Paleari, Barbara Zerega, Maria Pia Postiglione, Stefano Mantero, Eva Bober, Ottavia Barbieri, Antonio Simeone and Giovanni Levi |
| Title | Craniofacial, vestibular and bone defects in mice lacking the Distal-less-related gene Dlx5 |
| Journal | Development |
| Volume | 126 |
| Page | 3795-3809 |
| Year | 1999 |
| PMID | 10433909 |
| Disease name, Applicable field |