| CARD ID | 567 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129-Gsctm1Card | |
| Internal Code | goosecoid, B6;129-Gsctm1Card | |
| Submitter | Yamada Gen | |
| Submitter affiliation or code | Department of Developmental Genetics Research, Wakayama Medical University (WMU) | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | Max-Planck-Institute(MPI・ドイツ) |
| Organization code | ||
| Developer | Gen Yamada | |
| Year introduced | 1994 | |
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Gsc |
| Gene name | goosecoid |
| Allele symbol | Gsctm1Card |
| Allele name | targeted mutation 1, Center for Animal Resources and Development, Kumamoto University |
| MGI | MGI:95841, |
| Chromosome | 12 (52.0) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM | OMIM ID: 138890 Human Gene Symbol: GSC, |
| Gsc-S46 | GTGCCGAGGGAGGATGACTGAC |
| Gsc-N2 | TAGCCTCTCCACCCAAGCGGC |
| Author | Gen Yamada, Ahmed Mansouri, Miguel Torres, Edward T. Stuart, Martin Blum, M. Schultz, Eddy M. De Robertis and Peter Gruss |
| Title | Targeted mutation of the murine goosecoid gene results in craniofacial defects and neonatal death |
| Journal | Development |
| Volume | 121 |
| Page | 2917-2922 |
| Year | 1995 |
| PMID | 7555718 |
| Disease name, Applicable field | Development |