CARD ID | 1288 | |
Type of strain | Transgenic. | |
Strain name | C57BL/6J-Tg(mGluR6-hrGFP)11Nkj | |
Internal Code | Tg(mGluR6-hrGFP)11Nkj | |
Submitter | - - | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Department of Biological Sciences, Faculty of Medicine, Kyoto University |
Organization code | Nkj | |
Developer | Yoshiaki Nakajima | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | hrGFP |
Gene name | humanized Renilla reniformis green fluorescent protein |
Allele symbol | Tg(mGluR6-hrGFP)11Nkja |
Allele name | transgene insertion 11, Yoshiaki Nakajima |
MGI | |
Chromosome | Unknown , |
Gene classification | Gene to express(transgenic) |
Method | MicroInjection |
OMIM |
hrGFPf2 | GCAACCAGCTGGTGCAGATC |
hrGFPr2 | TCCTCCACGTAGGTCTTCTC |
Disease name, Applicable field | Physiology, Anatomy, Development, Neurobiology, Metabolism |