CARD ID | 3228 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-Ror1tm1 | |
Internal Code | Ror1f/f | |
Submitter | Takashi Takahashi | |
Submitter affiliation or code | Aichi Cancer Center | |
Stock Type | ||
Material Transfer Conditions |
Others
|
|
Production method | From other organizations | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | UNITEC |
Organization code | 不明 | |
Developer | ||
Year introduced | 2013 / 3 | |
Introduced Generation | ||
Remarks |
Gene symbol | Ror1 |
Gene name | receptor tyrosine kinase-like orphan receptor 1 |
Allele symbol | Ror1tm1 |
Allele name | receptor tyrosine kinase-like orphan receptor 1; targeted mutation 1, |
MGI | MGI:1347520, |
Chromosome | |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | MicroInjection |
OMIM |
Ror1 flox-F | ATGATAGAACGCTGGCTTTGAGAC |
Ror1 flox-R | CTAACTTCTAGGGGACTCTCAATCC |
Author | Isomura H, Taguchi A, Kajino T, Asai N, Nakatochi M, Kato S, Suzuki K,Yanagisawa K, Suzuki M, Fujishita T, Yamaguchi T, Takahashi M, Takahashi T. |
Title | Conditional Ror1 knockout reveals crucial involvement in lung adenocarcinomadevelopment and identifies novel HIF-1α regulator. |
Journal | Cancer Sci. |
Volume | 112 |
Page | 1614 |
Year | 2021 |
PMID | 33506575 |
Disease name, Applicable field | Metabolism, Neurobiology, Dermatology, cancer, Immunology, Development, Anatomy, Physiology |