| CARD ID | 2901 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Uacatm1 | |
| Internal Code | Nucling-KO mouse | |
| Submitter | Ishidoh Kazumi | |
| Submitter affiliation or code | Tokushima Bunri University, Institute for Health Sciences | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Tokushima Bunri University, Institute for Health Sciences |
| Organization code | ||
| Developer | TAKASHI SAKAI | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Uaca |
| Gene name | uveal autoantigen with coiled-coil domains and ankyrin repeats |
| Allele symbol | Uacatm1 |
| Allele name | uveal autoantigen with coiled-coil domains and ankyrin repeats; targeted mutation 1, |
| MGI | MGI:1919815, |
| Chromosome | 9 (32.93) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | MicroInjection |
| OMIM |
| NeoC1 | ccggtggatgtggaatgtgtgcgagg |
| C3A1 | ctccgcgtatctctgtgttgcctccga |
| Author | Sakai T, Liu L, Teng X, Ishimaru N, Mukai-Sakai R, Tran NH, Kim SM, Sano N, Hayashi Y, Kaji R, Fukui K |
| Title | Inflammatory disease and cancer with a decrease in Kupffer cell numbers in Nucling-knockout mice. |
| Journal | Int J Cancer. |
| Volume | 126 |
| Page | 1079-94 |
| Year | 2010 |
| PMID |
| Disease name, Applicable field | Immunology, Obesity, Diabetes, cancer, Metabolism, Digestive Disorders |