| CARD ID | 1093 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6.129-Edg3tm1Jch | |
| Internal Code | SIP3-Knockout | |
| Submitter | ISHII ISAO | |
| Submitter affiliation or code | Showa Pharmaceutical University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | Showa Pharmaceutical University |
| Organization code | ||
| Developer | Isao Ishii | |
| Origin (From other organizations) | Organization | The Scripps Research Institute |
| Organization code | Jch | |
| Developer | Dr. Jerold Chun | |
| Year introduced | 2005 / 4 | |
| Introduced Generation | N5+F? | |
| Remarks | ||
| Gene symbol | Edg3 |
| Gene name | endothelial differentiation, sphingolipid G-protein-coupled receptor,3 |
| Allele symbol | Edg3tm1Jch |
| Allele name | targeted mutation 1, Jerold Chun |
| MGI | |
| Chromosome | 13 (13B1) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | MicroInjection |
| OMIM |
| Edg3-1(HX1) | ATCGATACCGTCGTCGACCT |
| Edg3-2(B3-back) | CACAGCAAGCAGACCTCCAGA |
| Author | Means CK, Xiao CY, Li Z, Zhang T, Omens JH, Ishii I, et al. |
| Title | Sphingosine 1-phosphate S1P2 and S1P3 receptor-mediated Akt activation protects against in vivo myocardial ischemia-reperfusion injury. |
| Journal | Am J Physiol Heart Circ Physiol |
| Volume | 292 |
| Page | H2944-H2951 |
| Year | 2007 |
| PMID |
| Author | Takuwa N, Ohkura S, Takashima S, Ohtani K, Okamoto Y, Tanaka T, et al. |
| Title | S1P3-mediated cardiac fibrosis in sphingosine kinase 1 transgenic mice involves reactive oxygen species. |
| Journal | Cardiovasc Res |
| Volume | 85 |
| Page | 484-493 |
| Year | 2010 |
| PMID |
| Author | Isao Ishii, Beth Friedman, Xiaoqin Ye, Shuji Kawamura, Christine McGiffert, James J. A. Contos, Marcy A. Kingsbury, Guangfa Zhang, Joan Heller Brown, and Jerold Chun |
| Title | Selective Loss of Sphingosine 1-Phosphate Signaling with No Obvious Phenotypic Abnormality in Mice Lacking Its G Protein-coupled Receptor,LPB3/EDG-3 |
| Journal | J. Biol. Chem. |
| Volume | 276 |
| Page | 33697-33704 |
| Year | 2001 |
| PMID |
| Disease name, Applicable field | Physiology, Development, Immunology, Neurobiology, Metabolism |