| CARD ID | 2850 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Taf7l2em1 | |
| Internal Code | 4933416C03Rik/TAF7L2 | |
| Submitter | Ishiguro Kei-ichiro | |
| Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Taf7l2 |
| Gene name | Taf7l2 |
| Allele symbol | 4933416C03Rikem1 |
| Allele name | Taf7l2; endonuclease-mediated mutation 1, |
| MGI | MGI:6274337, |
| Chromosome | 10 (64.48) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| 4933416C03Rik-F1 | GAGGAGGTGTAGAGGCAAACAGAGG |
| 4933416C03Rik-R1 | CAAGATCAATTGGGACCCTTTAAGC |
| Disease name, Applicable field | Molecular biology, Cell biology, Reproduction |