CARD ID | 2522 | |
Type of strain | Targeted mutant. | |
Strain name | STOCK Spata16em2Osb | |
Internal Code | Spata16 KO | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Others
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
|
Production method | ||
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Spata16 |
Gene name | spermatogenesis associated 16 |
Allele symbol | Spata16em2Osb |
Allele name | spermatogenesis associated 16, endonuclease-mediated mutation 2, Research Institute for Microbial Diseases, Osaka University |
MGI | MGI:1918112, |
Chromosome | 3 (10.74) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
OMIM |
6753 | GCCCACTCTGGTTAACTGGGACCC |
CCATCATCACTAATGACCTCATGGCTGG |
Author | Fujihara Y, Oji A, Larasati T, Kojima-Kita K, Ikawa M |
Title | Human Globozoospermia-Related Gene Spata16 Is Required for Sperm Formation Revealed by CRISPR/Cas9-Mediated Mouse Models. |
Journal | Int J Mol Sci. |
Volume | 18 |
Page | 10 |
Year | 2017 |
PMID |
Disease name, Applicable field |