| CARD ID | 1924 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;CB-SemaCap3tm1 | |
| Internal Code | B6-S;emaCap3-KO | |
| Submitter | Kato Masashi | |
| Submitter affiliation or code | Nagoya University Graduate School of Medicine Department of Occupational and Environmental Health | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | 2010 / 11 | |
| Introduced Generation | F2-3 | |
| Remarks | ||
| Gene symbol | SemaCap3 (New symbol: Pdzrn3) |
| Gene name | Semaphorin cytoplasmic domain-associated protein 3 (New name: PDZ domain containing RING finger 3) |
| Allele symbol | SemaCap3tm1 |
| Allele name | targeted mutation 1, Yumiko Saga, National Institute of Genetics |
| MGI | MGI:1933157, |
| Chromosome | 6 (46.95 ) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| pr0771 | ACCTCTAGCTGCTAAACACTGCAGTTTGC |
| pr0775 | GGAGATGTTTTAATTCAAGGAGGCTATCAC |
| Disease name, Applicable field | Unknown |