CARD ID | 2625 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-M1apem2 | |
Internal Code | M1ap- Ex1crispr 20ins | |
Submitter | Ishiguro Kei-ichiro | |
Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | M1ap |
Gene name | Meiosis 1 associated protein |
Allele symbol | M1apem2 |
Allele name | Meiosis 1 associated protein, endonuclease-mutation 2, |
MGI | MGI:1315200, |
Chromosome | 6 (35.94) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
M1ap-19439F | ACCTGATCCAATTTTATGAAAGCCAGTC |
M1ap-19851R | CAACTGTGAGTTCTGCTATGGAAATCTC |
Disease name, Applicable field | Cell biology, Reproduction |