CARD ID | 1771 | |
Type of strain | Targeted mutant. | |
Strain name | B6;CB-Bnc2tm3(Bnc2)12Card | |
Internal Code | B6;CB-Bnc2tm3(Bnc2)12Card | |
Submitter | Masatake ARAKI | |
Submitter affiliation or code | Gene Technology Center, IRDA, Kumamoto University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | Card | |
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Bnc2 |
Gene name | Basonuclin 2 |
Allele symbol | Bnc2tm3(Bnc2)12Card |
Allele name | Basonuclin 2; targeted mutation 3, Center for Animal Resources & Development |
MGI | |
Chromosome | 4 (39.76) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
SA-11 | CCCGAAAACCAAAGAAGAAG |
Bnc2-1 | GGTTAGTGTCAGCGTTTTGCC |
Author | Tashiro, F., Kanai-Azuma, M., Miyazaki, S., Kato, M., Tanaka, T., Toyoda , S., Yamato, E., Kawakami, H., Miyazaki, T. and Miyazaki, J. |
Title | Maternal-effect gene Ces5/Ooep/Moep19/Floped is essential for oocyte cytoplasmic lattice formation and embryonic development at the maternal-zygotic stage transition |
Journal | Genes Cells |
Volume | 15 |
Page | 813-828 |
Year | 2010 |
PMID |
Disease name, Applicable field | Development |