CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2901
Type of strain Targeted mutant.
Strain name C57BL/6-Uacatm1
Internal Code Nucling-KO mouse
Submitter Ishidoh Kazumi
Submitter affiliation or code Tokushima Bunri University, Institute for Health Sciences
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Tokushima Bunri University, Institute for Health Sciences
Organization code
Developer TAKASHI SAKAI
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Uaca
Gene name uveal autoantigen with coiled-coil domains and ankyrin repeats
Allele symbol Uacatm1
Allele name uveal autoantigen with coiled-coil domains and ankyrin repeats; targeted mutation 1,
MGI MGI:1919815,
Chromosome 9 (32.93) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method MicroInjection
OMIM

PCR Primer 1
NeoC1 ccggtggatgtggaatgtgtgcgagg
C3A1 ctccgcgtatctctgtgttgcctccga


References

Author Sakai T, Liu L, Teng X, Ishimaru N, Mukai-Sakai R, Tran NH, Kim SM, Sano N, Hayashi Y, Kaji R, Fukui K
Title Inflammatory disease and cancer with a decrease in Kupffer cell numbers in Nucling-knockout mice.
Journal Int J Cancer.
Volume 126
Page 1079-94
Year 2010
PMID


Disease , Applicable field information

Disease name, Applicable field Immunology, Obesity, Diabetes, cancer, Metabolism, Digestive Disorders






Copyright @ 2021 Kumamoto University. All rights reserved.