CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2066
Type of strain Targeted mutant.
Strain name MSM/Ms-Hnf1atm1Card
Internal Code MSM/Ms-Hnf1atm1Card
Submitter Yamamura Ken-ichi
Submitter affiliation or code -
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization
Organization code Card
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Hnf1a
Gene name HNF1 homeobox A
Allele symbol Hnf1atm1Card
Allele name HNF1 homeobox A, targeted mutation 1, Naomi Nakagata
MGI MGI:98504,
Chromosome 5 (55.99) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
neo_3AR4 AAGATATCATTTCAAAGGCTGGCATGCG
neo_G02 ATCAGGACATAGCGTTGGCTAC


Disease , Applicable field information

Disease name, Applicable field Diabetes






Copyright @ 2021 Kumamoto University. All rights reserved.