CARD ID | 2618 | |
Type of strain | Targeted mutant. | |
Strain name | B6D2-Ppp3r2em1Osb | |
Internal Code | Ppp3r2 KO | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Ppp3r2 |
Gene name | protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type II) |
Allele symbol | Ppp3r2em1Osb |
Allele name | protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type II), endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
MGI | MGI:107171, |
Chromosome | 4 (26.75) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
OMIM |
Ppp3r2Fw | AAGAATTCCCAGGCCAACGGTAGCACGG |
Ppp3r2Rv | AAGGATCCAAACTCACACAAACACGACC |
Disease name, Applicable field |