| CARD ID | 479 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129-Six1tm1(Sall1neo-)Imeg | |
| Internal Code | Six1 KO | |
| Submitter | Nishinakamura Ryuichi | |
| Submitter affiliation or code | Department of Kidney Development, Institute of Molecular Embryology and Genetics Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | ||
| Origin (In-house) | Organization | IMEG, Division of Integrative Cell Biology |
| Organization code | Imeg | |
| Developer | Ryuichi Nishinakamura | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Six1 |
| Gene name | sine oculis-related homeobox 1 homolog (Drosophila) |
| Allele symbol | |
| Allele name | |
| MGI | MGI:102780, |
| Chromosome | 12 (31.0cM) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Six1 Sall1(neo-) <WtSix1 Fwd2, Six1 Sall1KI-neo Fwd2, W+Six1 Rev2> mixture of 10μM each | CACCTCCAGTTTGGTGGACTTGG, CAATGCCCTGGCTCACAAATACC, and TTGGAGAGGAGGGAGAGGATGC |
| |
| Author | |
| Title | |
| Journal | |
| Volume | |
| Page | |
| Year | |
| PMID |
| Disease name, Applicable field |