CARD ID | 2141 | |
Type of strain | Targeted mutant. | |
Strain name | B6D2-Ly6ktm1Osb | |
Internal Code | Ly6k KO | |
Submitter | Ikawa Masahito | |
Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | in-house breeding | |
Origin (In-house) | Organization | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University |
Organization code | Osb | |
Developer | Masahito Ikawa | |
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | ||
Introduced Generation | ||
Remarks |
Gene symbol | Ly6k |
Gene name | Lymphocyte antigen 6 complex, locus K |
Allele symbol | Ly6ktm1Osb |
Allele name | lymphocyte antigen 6 complex, locus K, targeted mutation 1, Research Institute for Microbial Diseases,Osaka University |
MGI | MGI:1923736, |
Chromosome | 15 (34.28) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | |
OMIM |
#719 | GCCTTCTATCGCCTTCTTGACGAGTTCTTC |
#5577 | GCAAGGCCACTAGGAACGCC |
#5578 | GGCACGGGCTGCTGAGG |
Author | Fujihara Y, Okabe M, Ikawa M. |
Title | GPI-anchored protein complex, LY6K/TEX101, is required for sperm migration into the oviduct and male fertility in mice. |
Journal | Biol Reprod |
Volume | 90(3) |
Page | 60 |
Year | 2014 |
PMID |
Disease name, Applicable field | Others |