CARD R-BASE



Mouse strain


Strain information

CARD ID 1896
Type of strain Transgenic.
Strain name B6;BALB-Tg(Krt19-Wnt1/K19-Ptgs2/K19-Ptges)
Internal Code B6;BALB-Tg(Krt19-Wnt1/K19-Ptgs2/K19-Ptges), K19-Wnt1/C2mE(B6;BALB)
Submitter Masanobu Oshima
Submitter affiliation or code Division of Genetics, Cancer Research Institute, Kanazawa University
Stock Type
Material Transfer Conditions Others
Production method in-house breeding
Origin (In-house) Organization Cancer Research Institute, Kanazawa Univ.
Organization code
Developer Masanobu Oshima
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Wnt1, Ptgs2, Ptges
Gene name wingless-type MMTV integration site family, member 1; prostaglandin-endoperoxide synthase 2; prostaglandin E synthase
Allele symbol
Allele name
MGI MGI:98953,
Chromosome Unknown ,
Gene classification Gene to express(transgenic)
Method MicroInjection
OMIM OMIM ID: 164820 Human Gene Symbol: WNT1, OMIM ID: 600262 Human Gene Symbol: PTGS2, OMIM ID: 605172 Human Gene Symbol: PTGES,

PCR Primer 1
Wnt1F,COX-2-F3 CGACCGTGTTCTCTGAGATG,CAAACTCAAGTTTGACCCAG
HA-R,COX-2-R1 CATCATATGGGTAGGCCATGG,CTTTTACAGCTCAGTTGAACG


References

Author Oshima H and Oshima M
Title Mouse models of gastric tumors: Wnt activation and PGE2 induction.
Journal Pathology International
Volume 60 (9)
Page 599-607
Year 2010
PMID
Author Oshima H, Oguma K, Du YC and Oshima M
Title Prostaglandin E2, Wnt, and BMP in gastric tumor mouse models.
Journal Cancer Science
Volume 100 (10)
Page 1779-1785
Year 2009
PMID
Author Oshima H, Matsunaga A, Fujimura T, Tsukamoto T, Taketo MM, Oshima M.
Title Carcinogenesis in mouse stomach by simultaneous activation of the wnt signaling and prostaglandin e(2) pathway.
Journal Gastroenterology
Volume 131
Page 1086-1095
Year 2006
PMID


Disease , Applicable field information

Disease name, Applicable field cancer






Copyright @ 2021 Kumamoto University. All rights reserved.