CARD ID | 2760 | |
Type of strain | Targeted mutant. | |
Strain name | C57BL/6-Mtss1tm1 | |
Internal Code | B6-Mtss1tm1 | |
Submitter | kengaku mineko | |
Submitter affiliation or code | - | |
Stock Type | ||
Material Transfer Conditions |
Consent to us
|
|
Production method | From other organizations | |
Origin (In-house) | Organization | |
Organization code | ||
Developer | ||
Origin (From other organizations) | Organization | |
Organization code | ||
Developer | ||
Year introduced | 2013 / 1 | |
Introduced Generation | ||
Remarks |
Gene symbol | Mtss1 |
Gene name | metastasis suppressor 1 |
Allele symbol | Mtss1tm1 |
Allele name | metastasis suppressor 1, targeted mutation 1, |
MGI | MGI:2384818, |
Chromosome | 15 (25.09) , |
Gene classification | Targeted or trapped gene(knockout etc.) |
Method | Electroporation |
OMIM |
A_ - s-neocassette-f | GGAATGAGATCCGCTTTCCC |
B_ - s-neocassette-r | TCAAGCTGCAAGTGCCAGCT |
Author | Kawabata Galbraith K |
Title | MTSS1 Regulation of Actin-Nucleating Formin DAAM1 in Dendritic Filopodia Determines Final Dendritic Configuration of Purkinje Cells. |
Journal | |
Volume | |
Page | |
Year | |
PMID |
Disease name, Applicable field | Development, Cell biology |