| CARD ID | 2522 | |
| Type of strain | Targeted mutant. | |
| Strain name | STOCK Spata16em2Osb | |
| Internal Code | Spata16 KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Others
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
|
| Production method | ||
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Spata16 |
| Gene name | spermatogenesis associated 16 |
| Allele symbol | Spata16em2Osb |
| Allele name | spermatogenesis associated 16, endonuclease-mediated mutation 2, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:1918112, |
| Chromosome | 3 (10.74) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| 6753 | GCCCACTCTGGTTAACTGGGACCC |
| CCATCATCACTAATGACCTCATGGCTGG |
| Author | Fujihara Y, Oji A, Larasati T, Kojima-Kita K, Ikawa M |
| Title | Human Globozoospermia-Related Gene Spata16 Is Required for Sperm Formation Revealed by CRISPR/Cas9-Mediated Mouse Models. |
| Journal | Int J Mol Sci. |
| Volume | 18 |
| Page | 10 |
| Year | 2017 |
| PMID |
| Disease name, Applicable field |