| CARD ID | 3260 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Vgfem1 | |
| Internal Code | Vgf-KO | |
| Submitter | Shimamura Kenji | |
| Submitter affiliation or code | Institute for Molecular Embryology and Genetics, Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Kumamoto university |
| Organization code | 3991 | |
| Developer | Haruka Takemoto | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Vgf |
| Gene name | Vgf nerve growth factor inducible |
| Allele symbol | Vgfem1 |
| Allele name | Vgf nerve growth factor inducible; endonuclease-mediated mutation 1, |
| MGI | MGI:1343180, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Vgf_GenomeSeq_FW1 | GGTACCCAGAAGGAGGATTG |
| Vgf_GenomeSeq_RV2 | TTGCTCGGACTGAAATCTCG |
| Author | Haruka Sato, Jun Hatakeyama, Takuji Iwasato, Kimi Araki, Nobuhiko Yamamoto, Kenji Shimamura |
| Title | Thalamocortical axons control the cytoarchitecture of neocortical layers by area-specific supply of VGF |
| Journal | eLife |
| Volume | 11 |
| Page | |
| Year | 2022 |
| PMID | 35289744 |
| Disease name, Applicable field | Ophthalomology, Neurobiology, Development, Anatomy |